DNA barcoding of edible freshwater gastropods and bivalves found in Nagaland

Lanusangla Imsong

Abstract


Freshwater gastropods and bivalves of phylum Mollusca are extensively distributed in various freshwater habitats of Nagaland. Molluscs are considered to be ecologically important and highly favored as traditional food item because of its nutrition, medicinal properties and low cost. This reflects the need of proper identification and documentation. However, the identification based on morphological characters is challenging due to the existence of cryptic species that shows similar morphology which can lead to erroneous identification of species. The primary objective of this study is to identify the edible mollusc species in Nagaland by DNA bar coding technique using a fragment of cytochrome oxidase I (COI) gene. Genomic DNA of the species was successfully isolated from the tissues and the primers used for forward and reverse amplification process are LCO (5’ GGTCAACAAATCATAAAGATATTGG 3’) and HCO (5’ TAAACTTCAGGGTGACCAAAAAATCA 3’). The sequence was analyzed with those available in GenBank and uploaded in NCBI to obtain accession number. The molecular identification was consistent with the identification of species based on shell and teeth morphology. The molecular method helped identify 4 species of bivalves and 3 species of gastropods. The name of the species with the NCBI accession number is as follows- Lamellidens marignalis (MT490309), Parreysia (Parreysia) corrugata (OM074301), Indonaia subclatharata (OM075118), Radiatula caerulea (OM076974), Filopaludina bengalensis (MT089706), Paludomus (Paludomus) siamensis (OM078498), Brotia costula (OM056887).

Full Text:

LANUSANGLA ET AL

Refbacks

  • There are currently no refbacks.


Published by:

Indian Science and Technology Foundation (ISTF)

 C-1/31, Yamuna Vihar, New Delhi-110053 

www.isto-india.org

Email: contact@isto-india.org